EFFECT OF LEPTIN LEP -2548G>A (rs7799039) AND LEPTIN RECEPTOR LEPR 223Q>R (rs1137101) GENE POLYMORPHIC VARIANTS ON THE DEVELOPMENT OF CARDIOVASCULAR COMPLICATIONS IN PATIENTS WITH TYPE 2 DIABETES MELLITUS

Authors

  • Plohotnichenko О. О. SI «V. Danilevsky Institute for Endocrine Pathology Problems of the NAMS of Ukraine», Kharkiv, Ukraine
  • Krasova N. S. SI «V. Danilevsky Institute for Endocrine Pathology Problems of the NAMS of Ukraine», Kharkiv, Ukraine https://orcid.org/0000-0002-7113-7616
  • Kolesnikova A. O. SI «V. Danilevsky Institute for Endocrine Pathology Problems of the NAMS of Ukraine», Kharkiv, Ukraine https://orcid.org/0000-0002-3799-0402
  • Gorshunska M. Yu. Kharkiv Medical Academy of Postgraduate Education of the Ministry of health of Ukraine, Kharkiv, Ukraine https://orcid.org/0000-0002-4402-9441
  • Pochernyaev A. K. SI «V. Danilevsky Institute for Endocrine Pathology Problems of the NAMS of Ukraine», Kharkiv, Ukraine https://orcid.org/0000-0001-9520-4492
  • Mamontov I. M. Kharkiv Medical Academy of Postgraduate Education of the Ministry of health of Ukraine, Kharkiv, Ukraine https://orcid.org/0000-0003-0059-2715
  • Voropay T. I. SI «V. Danilevsky Institute for Endocrine Pathology Problems of the NAMS of Ukraine», Kharkiv, Ukraine
  • Romanova I. P. SI «V. Danilevsky Institute for Endocrine Pathology Problems of the NAMS of Ukraine», Kharkiv, Ukraine
  • Karachentsev Yu. I. SI «V. Danilevsky Institute for Endocrine Pathology Problems of the NAMS of Ukraine», Kharkiv, Ukraine https://orcid.org/0000-0003-1317-6999
  • Poltorak V. V. SI «V. Danilevsky Institute for Endocrine Pathology Problems of the NAMS of Ukraine», Kharkiv, Ukraine https://orcid.org/0000-0002-3717-4413

DOI:

https://doi.org/10.21856/j-PEP.2022.4.07

Keywords:

type 2 diabetes mellitus, cardiovascular complications, leptin, leptin receptor, single nucleotide polymorphisms

Abstract

The search for functional single-nucleotide polymorphisms (SNPs) of genes that affect the risk of obesity, type 2 diabetes mellitus, and associated vascular complications development is actively ongoing. The aim of the study: to evaluate the effect of the leptin LEP -2548G/A and the leptin receptor LEPR 223Q/R gene SNPs on the risk of cardiovascular complications development in patients with type 2 diabetes mellitus in the Eastern Ukrainian population over time.

Materials and methods. Type 2 diabetic (T2D) patients at the initial examination and 10 years later were evaluated. During this time, 5 non-fatal heart attacks and 16 deaths due to cardiovascular disease were registered in the study group (n=60). At baseline, 60 T2D patients (F/M: 26/34) aged 53.35±1.38 yrs, duration of diabetes 5.33±0.67 yrs, with a HbA1c 7.74±0.19%, body mass index 33.28±0.89 kg/m2, waist-to-hip ratio 0.99±0.01 were examined. Genotyping was performed by polymerase chain reaction and restriction fragment length polymorphism using appropriate primers (LEP 2548G/A: forward: tcccatgagaactattcttttttg; reverse: atatggctccctttgcccgacc; LEPR 223Q/R: forward: acctctggttccccaaaag; reverse: tcatcattttagtgcataacttaccc) and endonucleases (HhaI and MspI, respectively). Restriction products were analyzed by electrophoresis in a 2% agarose gel. pUC19 DNA hydrolyzed by MspI endonuclease (MBI Fermentas, Lithuania) was used as a molecular weight marker. Unpaired two-tailed Student's t-test, Mann-Whitney test and χ2-test were used; probability (P) value of 5% or less was considered statistically significant.

Results. It was determined that SNP LEP -2548G/A significantly affects the development of cardiovascular complications in T2D patients in the Eastern Ukrainian population, namely, the A-allele is associated with an increased risk of heart failure in women and heart failure and coronary heart disease in men. The presence of a heterozygous genotype for the LEPR 223Q/R polymorphism is associated with a lower risk of heart failure development in T2D men in the Eastern Ukrainian population. Minor genotypes, namely, AA by the LEP -2548G/A polymorphism and RR by the LEPR 223Q/R polymorphism, significantly increase in the risk of mortality related to cardiovascular events (OR (AA) = 21.00; CI 3.75-117.76, P<0.05; OR (RR) = 5.00; CI 1.343-18.62, P<0.05, respectively).

Conclusions. The functional significance of single-nucleotide polymorphisms LEP -2548G/A and LEPR 223Q/R in relation to the development of cardiovascular complications in patients with type 2 diabetes mellitus in the Eastern Ukrainian population has been proven. Data on the studied polymorphic variants of the leptin and leptin receptor genes can be used to form risk groups and be taken into account when choosing effective preventive and therapeutic strategies.

References

Leon BM, Maddox TM. World J Diabetes 2015;6(13): 1246-1258.

Glovaci D, Fan W, Wong ND. Curr Cardiol Rep 2019;21(4): 21. http://doi.org/10.1007/s11886-019-1107-y.

De Rosa S, Arcidiacono B, Chiefari E, et al. Front Endocrinol (Lausanne) 2018;9(2). http://doi.org/10.3389/fendo.2018.00002.

Zeng R, Xu CH, Xu YN, et al. Arq Bras Endocrinol Metabol 2014;58: 817-823.

Recinella L, Orlando G, Ferrante C, et al. Front Physiol 2020;11: 578966. http://doi.org/10.3389/fphys.2020.578966.

Katsiki N, Mikhailidis DP, Banach M. Acta Pharmacol Sin 2018;39(7): 1176-1188. http://doi.org/10.1038/aps.2018.40.

Zhang L, Lu M, Yuan L, et al. Wei Sheng Yan Jiu 2014;43(1): 128-132.

Consortium T 1000 GP. Nature 2012;491: 56-65.

Daghestani M, Purohit R, Daghestani M, et al. PLOS One 2019;14: e0211381.

Yang MM, Wang J, Fan JJ, et al. J Diabetes Res 2016;2016: 5412084.

Saukko M, Kasaniemi YA, Ukkola O. Metab Syndr Relat Disord 2010;8(5): 425-430.

Krasova NS, Karachentsev YuI, Gorshunska MYu, et al. Probl Endokrin Patol 2021;78(4): 27-33.

Matthews DR, Hosker JP, Rudenski AS, et al. Diabetologia 1985;28: 412-419.

Matsuhisa M, Yamasaki Y, Emoto M, et al. Diabetes Res Clin Pract 2007;77: 151-154.

Katz A, Nambi SS, Mather K, et al. J Clin Endocrinol Metab 2000;85: 2402-2410.

Inoue M, Yano M, Yamakado M, et al. Metabolism 2006;55: 1248-1254.

Adams-Huet B, Devaraj S, Siegel D, Jialal I. Metab Syndr Relat Disord 2014;12(10): 503-507.

Sabi EM, Bin Dahman LS, Mohammed AK, et al. Medicina (Kaunas) 2022;58(3): 346. http://doi.org/10.3390/medicina58030346.

Ben Ali S, Kallel A, Ftouhi B, et al. Blood Press 2008;17(5-6): 278-283. http://doi.org/10.1080/08037050802488960.

Downloads

Published

2022-12-15

How to Cite

Плохотніченко, О., Красова, Н., Колеснікова, А., Горшунська, М., Почерняєв, А., Мамонтов, І., Воропай, Т., Романова, І., Караченцев, Ю., & Полторак, В. (2022). EFFECT OF LEPTIN LEP -2548G>A (rs7799039) AND LEPTIN RECEPTOR LEPR 223Q>R (rs1137101) GENE POLYMORPHIC VARIANTS ON THE DEVELOPMENT OF CARDIOVASCULAR COMPLICATIONS IN PATIENTS WITH TYPE 2 DIABETES MELLITUS. Problems of Endocrine Pathology, 79(4), 52-60. https://doi.org/10.21856/j-PEP.2022.4.07

Issue

Section

CLINICAL ENDOCRINOLOGY

Most read articles by the same author(s)

1 2 3 > >>